Changes
Page history
Update Intersection between UK Biobank and Illumina GSA arrays
authored
Jun 04, 2020
by
ameyner2
Hide whitespace changes
Inline
Side-by-side
Intersection-between-UK-Biobank-and-Illumina-GSA-arrays.md
View page @
bd7fb10d
...
...
@@ -40,9 +40,9 @@ wc -l *.csv
UKB Axiom:
```
"Probe Set ID","Affy SNP ID","dbSNP RS ID","dbSNP Loctype","Chromosome","Physical Position","Position End","Strand","ChrX pseudo-autosomal region 1","Cytoband","Flank","Allele A","All
"AFFX-KIT-000001","Affx-32899432","rs1000440","2","9","101258881","101258881","+","0","q22.33","GGGCCAGTTCCGAGGGGTCACCCTGGGGAAGTCAA[C/T]TGGGCAAAGCGATTTTCTCTACCGACAATGCAAAG","T","C","T
"AFFX-KIT-000002","Affx-23811321","rs10007601","2","4","164934874","164934874","+","0","q32.3","CAGCAACTGTGCAGGTCACAAGGAAGTGAGATGAC[A/G]AAGTCAAAGTGCTGATGGAAAAAAAAATCTTTCAA","A","G","G
"Probe Set ID","Affy SNP ID","dbSNP RS ID","dbSNP Loctype","Chromosome","Physical Position","Position End","Strand","ChrX pseudo-autosomal region 1","Cytoband","Flank","Allele A","All
ele B","Ref Allele","Alt Allele","Associated Gene","Genetic Map","Microsatellite","Allele Frequencies","Heterozygous Allele Frequencies","Number of individuals","In Hapmap","Strand Versus dbSNP","Probe Count","ChrX pseudo-autosomal region 2","Minor Allele","Minor Allele Frequency","OMIM","Biomedical","Annotation Notes"
"AFFX-KIT-000001","Affx-32899432","rs1000440","2","9","101258881","101258881","+","0","q22.33","GGGCCAGTTCCGAGGGGTCACCCTGGGGAAGTCAA[C/T]TGGGCAAAGCGATTTTCTCTACCGACAATGCAAAG","T","C","T
","C","ENST00000259455 // intron // 0 // Hs.198612 // GABBR2 // 9568 // gamma-aminobutyric acid (GABA) B receptor, 2 /// ENST00000477471 // intron // 0 // Hs.198612 // GABBR2 // 9568 // gamma-aminobutyric acid (GABA) B receptor, 2 /// NM_005458 // intron // 0 // Hs.198612 // GABBR2 // 9568 // gamma-aminobutyric acid (GABA) B receptor, 2","101.1756 // D9S180 // D9S910 // --- // --- // deCODE /// 104.2453 // D9S753 // D9S910 // UT8063 // ATA18A07 // Marshfield /// 103.1261 // --- // --- // 59993 // 595969 // SLM1","D9S2007 // downstream // 284353 /// D9S763 // upstream // 151152","0.4176 // 0.5824 // CEU /// 0.8763 // 0.1237 // CHB /// 0.7584 // 0.2416 // JPT /// 0.3580 // 0.6420 // YRI","0.5765 // CEU /// 0.2268 // CHB /// 0.3483 // JPT /// 0.3977 // YRI","170 // CEU /// 194 // CHB /// 178 // JPT /// 176 // YRI","YES","reverse","1","0","T // CEU /// C // CHB /// C // JPT /// T // YRI","0.4176 // CEU /// 0.1237 // CHB /// 0.2416 // JPT /// 0.3580 // YRI","607340 // {Nicotine dependence, protection against} // 188890 // intron /// 607340 // {Nicotine dependence, susceptibility to} // 188890 // intron","---","---"
"AFFX-KIT-000002","Affx-23811321","rs10007601","2","4","164934874","164934874","+","0","q32.3","CAGCAACTGTGCAGGTCACAAGGAAGTGAGATGAC[A/G]AAGTCAAAGTGCTGATGGAAAAAAAAATCTTTCAA","A","G","G
","A","ENST00000503008 // intron // 0 // Hs.592804 // MARCH1 // 55016 // membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase /// ENST00000503104 // intron // 0 // Hs.592804 // MARCH1 // 55016 // membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase /// ENST00000505391 // intron // 0 // Hs.592804 // MARCH1 // 55016 // membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase /// ENST00000507270 // intron // 0 // Hs.592804 // MARCH1 // 55016 // membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase /// ENST00000508725 // intron // 0 // Hs.592804 // MARCH1 // 55016 // membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase /// ENST00000514618 // intron // 0 // Hs.592804 // MARCH1 // 55016 // membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase /// ENST00000515471 // intron // 0 // Hs.592804 // MARCH1 // 55016 // membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase /// NM_001166373 // intron // 0 // Hs.592804 // MARCH1 // 55016 // membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase","158.3192 // D4S1528 // D4S3339 // --- // --- // deCODE /// 164.5431 // D4S3033 // D4S2398 // AFMA054TD5 // ATA27E06 // Marshfield /// 157.0891 // --- // D4S2398 // 766823 // --- // SLM1","D4S2332 // downstream // 88185 /// D4S866 // upstream // 5284","0.8176 // 0.1824 // CEU /// 0.7835 // 0.2165 // CHB /// 0.8989 // 0.1011 // JPT /// 0.4943 // 0.5057 // YRI","0.2706 // CEU /// 0.3505 // CHB /// 0.1798 // JPT /// 0.5114 // YRI","170 // CEU /// 194 // CHB /// 178 // JPT /// 176 // YRI","YES","same","1","0","G // CEU /// G // CHB /// G // JPT /// A // YRI","0.1824 // CEU /// 0.2165 // CHB /// 0.1011 // JPT /// 0.4943 // YRI","---","---","---"
```
Illumina GSA:
...
...
...
...